Receptory adrenergiczne zapobiegają dezadaptacyjnej reakcji serca na przeciążenie ciśnieniowe ad 9

Całkowitą liczbę receptorów (Bmax) i powinowactwo wiązania (Kd) obliczono za pomocą nieliniowej regresji za pomocą GraphPad Prism (wersja 4.0b; oprogramowanie GraphPad). Procent a-2-AR oszacowano przez rywalizację o wiązanie [125I] cyjanopindololu (50 pM) przez ICI-118, 551 (1 nM <50 | jM), stosując test F, aby sprawdzić, czy model z dwoma miejscami był znacznie lepiej dopasowany niż model 1-miejscowy i obliczenie odsetka miejsc o wysokim powinowactwie do ICI-118, 551 (a2-AR) (GraphPad Prism wersja 4.0b; oprogramowanie GraphPad). Western blot a -AR i białka G. W przypadku a -AR, membrany wytworzono z serc i miocytów, tak samo jak w przypadku wiązania. Białka błonowe (50. 100. G) ponownie zawieszono w Tris-EDTA z PMSF i inhibitorami proteazy i załadowano, bez wrzenia, na 10% żele SDS-poliakryloamidowe. Białka błonowe do testu a2-AR najpierw potraktowano peptydem N-glikozydazą F, stosując zestaw z New England Biolabs Inc. (nr P0704S) (81, 82). Oddzielone białka przeniesiono na nitrocelulozę, zablokowano i sondowano króliczymi przeciwciałami poliklonalnymi z Santa Cruz Biotechnology Inc., SC-568 (V-19) dla a1-AR i SC-570 (M-20) dla. 2- AR. W przypadku białek G, serca lub miocyty zlizowano i poddano blottingowi z przeciwciałami z Santa Cruz Biotechnology Inc. przeciwko GRK2 (C-15, sc-562), Gs (K-20, sc-823), G. O (K- 20, sc-387), G q (E-17, sc-262) i G (i (C-10, sc-262). Przeciwciało przeciwko G. (06-238) pochodził z Upstate USA Inc., a przeciwciało przeciw GRK2 / 3 (G8972) pochodziło z mRNA United States Biological Inc. (3 -AR w sercu i miocytach. Test ochronny dla rybonukleazy dla mRNA y1 i a2-AR wykorzystał 15 .g całkowitego RNA (TRIzol) z serc lub izolowanych miocytów, ze znakowanymi sekwencyjnie znakowanymi sondami. Sondę A1-AR amplifikowano z biblioteki cDNA ludzkiego serca (nr 780612; Stratagene), stosując następujące startery: sens przy bp 411, 5 (3 -AGATGTGCTGTGTGTGAC-3y; i antysensowny w bp 701, 5a-TAGAAGGAGACGACGGAC-3 .. Mysz. Sonda 2-AR pochodziła od Briana Kobilki i Timothy ego Angelottiego (Stanford University, Stanford, California, USA). Ilościowy RT-PCR dla mRNA a-1, a 2- i a-3-AR wykorzystał całkowite miocyte RNA (TRIzol i RNeasy Mini Kit; Qiagen) traktowane DNazą TURBO (Ambion Inc.). Jeden mikrogram RNA poddano odwrotnej transkrypcji z użyciem starterów oligo-dT i odwrotnej transkryptazy SuperScript II (Invitrogen Corp.). Pięć procent produktu cDNA zastosowano w ilościowej reakcji PCR z SYBR Green i ABI PRISM 7900 Sequence Detection System. PCR wynosił 94 ° C przez 4 minuty, następnie 35 cykli w 94 ° C przez 2 minuty, 55 ° C przez minutę i 72 ° C przez 2 minuty, a następnie 72 ° C przez 10 minut. Dane analizowano za pomocą oprogramowania SDS w wersji 2.1 (Applied Biosystems). Produkty PCR oceniano również na żelach dla dimerów starterów lub innych nieswoistych prążków, które zostały dodatkowo wykluczone przez protokół dysocjacji pod koniec cyklu. Prasowanie 1-AR zostało zwalidowane za pomocą tkanek myszy. 1-AR KO (dane nie pokazane). Startery myszy. -AR zaprojektowano na PrimerQuest (Integrated DNA Technologies Inc.) z numerami akcesyjnymi i współrzędnymi w następujący sposób:. 1-AR forward, NM_007419 (641 AGTGCTGCGATTTCGTCACCAACA 664); 1-AR reverse, NM_007419 (787 GCTCGCAGCTGTCGATCTTCTTTA 764); A 2-AR do przodu, NM_007420 (912 ATCTGAAGGAAGATTCCACGCCCA 935); . 2-AR reverse, NM_007420 (1060 AGAGGGTGAATGTGCCCATGATGA 1037); Y 3-AR do przodu, NM_013462 (888 TGCGCACCTTAGGTCTCATTATGG 911); 3-AR reverse, NM_013462 (998 AAACTCCGCTGGGAACTAGAGAGG 975). cAMP i fosfolamban w miocytach. Myocyty hodowano przez noc i traktowano przez 10 minut nM <1 | 3 M ISO (7 dawek) lub podłożem, z podwójnymi szalkami dla każdej dawki w każdym doświadczeniu. Wewnątrzkomórkowe cAMP ekstrahowano i testowano za pomocą ELISA (Biotrak, Amersham Biosciences). Krzywe dopasowano do sigmoidalnych krzywych dawka-odpowiedź i porównano z testem F (GraphPad Prism wersja 4.0b; GraphPad Software). Niektóre hodowle wstępnie traktowano ug / ml PTX (List Biological Laboratories Inc.) przez 12-16 godzin w 37 ° C, następnie stymulowano przy użyciu 1. M ISO przez 10 minut. Inne hodowle traktowano .M forskoliny (Sigma-Aldrich) przez 10 minut. Fosforylację fosfolambanu po potraktowaniu hodowanych miocytów przy .M ISO mierzono za pomocą Western blot z anty-fosfo-fosfolambanem S16 (nr 07-052; Upstate USA Inc.). Pośredniczenie a -ARF w izolowanych sercach. Izolowane serca były stymulowane przy 9 Hz i perfundowane wsteczne przez aortę pod ciśnieniem 70 mmHg i 37 ° C ze zmodyfikowanym buforem Krebsa-Henseleita zawierającym 1,5 mM wapnia (83). Monitorowano ciśnienie LV za pomocą wypełnionego płynem balonu wprowadzonego przez lewe przedsionki (83), podczas gdy wartość ISO w Krebs-Henseleit podawano w infuzji od do 50 nM [patrz też: choroba refluksowa dieta, ciekawe aplikacje na telefon, odkwaszanie organizmu cytryna ] [patrz też: szczepionka na dur brzuszny, brak szczęścia w miłości, brzoskwinie wartości odżywcze ]